KEGG   Bacillus subtilis subsp. subtilis 168: BSU36668
Entry
BSU36668          gene      T00010                                 

Symbol
ywzE
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8303048
Position
complement(3769289..3769453)
NT seq 165 nt   +upstreamnt  +downstreamnt
atggtaaatctgaaaaatattttacttaataaacaattggaaggaattcagattttaatt
gtcgaactagtcagacaagttattatagaaatttccagaaaaaaagacatttgttatctt
agtcgagcgcagtctggaaaacgcgttaatctgatctttccgtga

DBGET integrated database retrieval system