KEGG   Bacillus subtilis subsp. subtilis 168: BSU36669
Entry
BSU36669          gene      T00010                                 

Symbol
ywzF
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8303130
Position
complement(3769626..3769808)
NT seq 183 nt   +upstreamnt  +downstreamnt
gtgaaggccggaattcttcactcattaagaggaacggtggcgatcagcgaagtgaccgtc
catgatgcggagttaatggcaatagtcgggttctcggtatcgtggaggtcggcgcctcag
actggcctccatgccatgcttccggttgcggagcaaaacaacgggctgccatcaggaatg
taa

DBGET integrated database retrieval system