KEGG   Bacillus subtilis subsp. subtilis 168: BSU39029
Entry
BSU39029          gene      T00010                                 

Symbol
yxiT
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8303043
Position
complement(4006987..4007415)
NT seq 429 nt   +upstreamnt  +downstreamnt
aaaacaaaaaagcaggcgaacagcagggctttaaaacgggaatatcaaacatccttcagc
gtcaaatacaatgcggcaggcaagctcagcattcaaacactcaattatatctattcaggg
ggcgcccacggtctaacgtctgtccagtccttcaactatgacttgaaagcacaaaagcgg
gtgacgctggatcagattctgaacaccaaaacaaaagtcagcaaaacgagagattaccta
tatagctatatcaaaaaacacgatgtgctgtttttctctgatgtaaagaaagaggatata
accctaaacagagacacaatgttttactttacggcaaacgggatcgccatcgtcttcggc
cagtatgacttggggccttatgcagcgggaatccgggatgtgcaggtgccagcctctatt
tatcaataa

DBGET integrated database retrieval system