KEGG   Bacillus subtilis subsp. subtilis 168: BSU39030
Entry
BSU39030          gene      T00010                                 

Symbol
yxiT
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 937459
Pasteur: BG11149
Position
complement(4007416..4007658)
NT seq 243 nt   +upstreamnt  +downstreamnt
atgaaatggaataacatgctgaaagccgcgggcattgcagtcttgcttttttctgtattt
gcatatgcggccccatctttaaaagcagttcaagcgaaaacaccgactgtcagcacccat
acgtacaaaaagatcaaggagttaacgtatccacaagtgcatcacgtcgggaatgccgcg
tttgaaaagaaaatcaatcaagagctgaaagcctacatgaacaatcgtatcaggaatacc
tga

DBGET integrated database retrieval system