KEGG   Bacillus subtilis subsp. subtilis 168: BSU39129
Entry
BSU39129          gene      T00010                                 

Symbol
yxzI
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8303194
Position
complement(4018786..4018974)
NT seq 189 nt   +upstreamnt  +downstreamnt
ttgcggtttgaaaacattagtgcatcaaagctggatgaccttgaatccatcgattcggtt
gcattggagattgtaccgactgacgatcaatgggaaagactccgttattatgtgtatgac
gaagaaaaccaaataagcttctattgcggaggttgggatgtgatcaagtgtgacaagaag
tcacactga

DBGET integrated database retrieval system