KEGG   Bacillus subtilis subsp. subtilis 168: BSU40573Help
Entry
BSU40573          gene      T00010                                 

Gene name
yyzI
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 8303121
Position
complement(4171396..4171635)
Genome map
NT seq 240 nt NT seq  +upstreamnt  +downstreamnt
gtgaattataaaaaacaaaaccagggattcggctccatttcaggagaccataatgatatc
cacgatattttagcgacaatagaggaaaacggcacacaggatgcttttcattatgaaggt
ggtcttcaaggaaaaaacgagcaggtgctcgaacagatagagcaggaaatgctagcttcg
gggcttgatatagaggaacaggacgaggagaaggtaaatggggacgggccgattctttga

DBGET integrated database retrieval system