KEGG   Bacillus subtilis subsp. subtilis 168: BSU40579Help
Entry
BSU40579          gene      T00010                                 

Gene name
yyzL
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 8302966
Position
complement(4172387..4172536)
Genome map
NT seq 150 nt NT seq  +upstreamnt  +downstreamnt
ttgttgaatcagcatacacttacgtactcaacaattgatcgcaaagactatcggtcatat
aaatcaaatcctgaaatatgtttgagaatattacacaaaatcaacgaaacgccagaaagt
cgttactcggtatgtatggcaaaaccataa

DBGET integrated database retrieval system