KEGG   Bacillus subtilis subsp. subtilis 168: BSU_misc_RNA_17Help
Entry
BSU_misc_RNA_17   misc_RNA  T00010                                 

Definition
(RefSeq) T-box
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 8303071
Position
1378233..1378443
Genome map
NT seq 211 nt NT seq  +upstreamnt  +downstreamnt
cattgagcgttgaagaggattagtaagcagacctttctgtgacagagagcaaaatgaatc
gctgaaacattttgccgcatgaaacctgccgaacctgccttggagtcctagggggaaaac
ctaggcgcataacctggcgttacaggagagcggagcgtgcacaagcgcgttcaatcaagg
tggtaccacggaaacccatttcgtccttatg

DBGET integrated database retrieval system