KEGG   Bacillus subtilis subsp. subtilis 168: BSU_misc_RNA_2Help
Entry
BSU_misc_RNA_2    misc_RNA  T00010                                 

Gene name
scr
Definition
(RefSeq) small cytoplasmic RNA (scRNA, 4.5S RNA), signal recognition particle-like (SRP) component
  KO
K01983  SRP RNA
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu03060  Protein export
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09123 Folding, sorting and degradation
   03060 Protein export
    BSU_misc_RNA_2 (scr)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_misc_RNA_2 (scr)
Non-coding RNAs [BR:bsu03100]
 Other RNA
  Signal recognition particle
   BSU_misc_RNA_2 (scr)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 8302906
Position
26533..26635
Genome map
NT seq 103 nt NT seq  +upstreamnt  +downstreamnt
cgtttgggtcctgcgcaatgggaattcatgaaccatgtcaggtccggaaggaagcagcat
taagtgaaacctctcatgtgccgcagggttgcctgggccgagc

DBGET integrated database retrieval system