KEGG   Bacillus subtilis subsp. subtilis 168: BSU_misc_RNA_22Help
Entry
BSU_misc_RNA_22   misc_RNA  T00010                                 

Definition
(RefSeq) PreQ1
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 8303131
Position
1439274..1439318
Genome map
NT seq 45 nt NT seq  +upstreamnt  +downstreamnt
gcgggagaggttctagctacaccctctataaaaaactaaggacga

DBGET integrated database retrieval system