KEGG   Bacillus subtilis subsp. subtilis 168: BSU_misc_RNA_35Help
Entry
BSU_misc_RNA_35   misc_RNA  T00010                                 

Gene name
rnpB
Definition
(RefSeq) RNA component of ribonuclease P (RNase P) (catalytic subunit, ribozyme)
  KO
K01978  M1 RNA
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03016 Transfer RNA biogenesis [BR:bsu03016]
    BSU_misc_RNA_35 (rnpB)
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_misc_RNA_35 (rnpB)
Transfer RNA biogenesis [BR:bsu03016]
 Prokaryotic Type
  5'processing factors
   Ribonucrease P
    BSU_misc_RNA_35 (rnpB)
Non-coding RNAs [BR:bsu03100]
 Other RNA
  Ribonuclease P
   BSU_misc_RNA_35 (rnpB)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 8303109
Position
complement(2331330..2331715)
Genome map
NT seq 386 nt NT seq  +upstreamnt  +downstreamnt
taacgttcgggtaatcgctgcagatcttgaatctgtagaggaaagtccatgctcgcacgg
tgctgagatgcccgtagtgttcgtgcctagcgaagtcataagctagggcagtctttagag
gctgacggcaggaaaaaagcctacgtcttcggatatggctgagtatccttgaaagtgcca
cagtgacgaagtctcactagaaatggtgagagtggaacgcggtaaacccctcgagcgaga
aacccaaattttggtaggggaaccttcttaacggaattcaacggagagaaggacagaatg
ctttctgtagatagatgattgccgcctgagtacgaggtgatgagccgtttgcagtacgat
ggaacaaaacatggcttacagaacgt

DBGET integrated database retrieval system