KEGG   Bacillus subtilis subsp. subtilis 168: BSU_misc_RNA_45Help
Entry
BSU_misc_RNA_45   misc_RNA  T00010                                 

Definition
(RefSeq) T-box
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 8303223
Position
complement(2897094..2897340)
Genome map
NT seq 247 nt NT seq  +upstreamnt  +downstreamnt
tgaaaagcgcagatgaggataagtagccttgataaagttttccacagagaaccgggttag
ctgagaaccggcgaagctttacaaggtgaactcgcctcagagtgccagtctgaaatgaca
gtaggacttggccgggtgaacttgattcactcgttactaaagcggatagaaatatccatg
agacggccgattaacaggccgtaaacaagggtggtaccgcggaaagaaaagccttttcgc
ccctttt

DBGET integrated database retrieval system