KEGG   Bacillus subtilis subsp. subtilis 168: BSU_misc_RNA_55
Entry
BSU_misc_RNA_55   tmRNA     T00010                                 

Symbol
ssrA
Name
(RefSeq) Evidence 1a: Function experimentally demonstrated in the studied strain; 10Sa RNA
  KO
K15035  transfer-messenger RNA
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_misc_RNA_55 (ssrA)
Non-coding RNAs [BR:bsu03100]
 Other RNA
  Unclassified
   BSU_misc_RNA_55 (ssrA)
SSDB
Other DBs
NCBI-GeneID: 8303058
Position
complement(3450710..3451071)
NT seq 362 nt   +upstreamnt  +downstreamnt
ggggacgttacggattcgacagggatggatcgagcttgagctgcgagccgagaggcgatc
tcgtaaacacgcacttaaatataactggcaaaactaacagttttaaccaaaacgtagcat
tagctgcctaataagcgcagcgagctcttcctgacattgcctatgtgtctgtgaagagca
catccaagtaggctacgcttgcgttcccgtctgagaacgtaagaagagatgaacagacta
gctctcggaaggcccgcccgcaggcaagaagatgagtgaaaccataaatatgcaggctac
gctcgtagacgcttaagtaatcgatgtttctggacgtgggttcgactcccaccgtctcca
ta

DBGET integrated database retrieval system