KEGG   Bacillus subtilis subsp. subtilis 168: BSU_rRNA_8Help
Entry
BSU_rRNA_8        rRNA      T00010                                 

Gene name
rrnJ-5S
Definition
(RefSeq) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu03010  Ribosome
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    BSU_rRNA_8 (rrnJ-5S)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:bsu03011]
    BSU_rRNA_8 (rrnJ-5S)
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_rRNA_8 (rrnJ-5S)
Ribosome [BR:bsu03011]
 Ribosomal RNAs
  Prokaryotes
   BSU_rRNA_8 (rrnJ-5S)
Non-coding RNAs [BR:bsu03100]
 Ribosomal RNA
  Large subunit rRNA
   BSU_rRNA_8 (rrnJ-5S)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 936652
Position
95237..95354
Genome map
NT seq 118 nt NT seq  +upstreamnt  +downstreamnt
tttggtggcgatagcgaagaggtcacacccgttcccataccgaacacggaagttaagctc
ttcagcgccgatggtagtcgggggtttccccctgtgagagtaggacgccgccaagcaa

DBGET integrated database retrieval system