KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_11Help
Entry
BSU_tRNA_11       tRNA      T00010                                 

Gene name
trnSL-Glu1
Definition
(RefSeq) tRNA-Glu
  KO
K14224  tRNA Glu
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_11 (trnSL-Glu1)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_11 (trnSL-Glu1)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  tRNA
   BSU_tRNA_11 (trnSL-Glu1)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 2914278
Position
70267..70338
Genome map
NT seq 72 nt NT seq  +upstreamnt  +downstreamnt
ggcccgttggtcaagcggttaagacaccgccctttcacggcggtaacacgggttcgaatc
ccgtacgggtca

DBGET integrated database retrieval system