KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_17Help
Entry
BSU_tRNA_17       tRNA      T00010                                 

Gene name
trnJ-Leu2
Definition
(RefSeq) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_17 (trnJ-Leu2)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_17 (trnJ-Leu2)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  tRNA
   BSU_tRNA_17 (trnJ-Leu2)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 2914249
Position
95861..95946
Genome map
NT seq 86 nt NT seq  +upstreamnt  +downstreamnt
gccggggtggtggaattggcagacacacaggacttaaaatcctgcggtaggtgactaccg
tgccggttcaagtccggccctcggca

DBGET integrated database retrieval system