KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_2
Entry
BSU_tRNA_2        tRNA      T00010                                 

Gene name
trnY-Asp
Definition
(RefSeq) tRNA-Asp
  KO
K14221  tRNA Asp
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_2 (trnY-Asp)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_2 (trnY-Asp)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_2 (trnY-Asp)
SSDB
Other DBs
NCBI-GeneID: 8302974
Position
complement(4154895..4154971)
NT seq 77 nt   +upstreamnt  +downstreamnt
ggtccggtagttcagttggttagaatgcctgcctgtcacgcaggaggtcgcgggttcgag
tcccgtccggaccgcca

DBGET integrated database retrieval system