KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_39Help
Entry
BSU_tRNA_39       tRNA      T00010                                 

Gene name
trnD-His
Definition
(RefSeq) tRNA-His
  KO
K14226  tRNA His
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_39 (trnD-His)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_39 (trnD-His)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_39 (trnD-His)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 8303088
Position
952495..952570
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
gcggttgtggcgaagtggttaacgcaccagattgtggctctggcactcgtgggttcgatt
cccatcaatcgcccca

DBGET integrated database retrieval system