KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_64
Entry
BSU_tRNA_64       tRNA      T00010                                 

Symbol
trnB-Met2
Name
(RefSeq) tRNA-Met
  KO
K14230  tRNA Met
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_64 (trnB-Met2)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_64 (trnB-Met2)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_64 (trnB-Met2)
SSDB
Other DBs
NCBI-GeneID: 8303035
Position
complement(3172600..3172676)
NT seq 77 nt   +upstreamnt  +downstreamnt
cgcggggtggagcagttcggtagctcgtcgggctcataacccgaaggtcgcaggttcaaa
tcctgcccccgcaacca

DBGET integrated database retrieval system