KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_7Help
Entry
BSU_tRNA_7        tRNA      T00010                                 

Gene name
trnSL-Ser1
Definition
(RefSeq) tRNA-Ser
  KO
K14233  tRNA Ser
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_7 (trnSL-Ser1)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_7 (trnSL-Ser1)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  tRNA
   BSU_tRNA_7 (trnSL-Ser1)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 2914247
Position
22292..22384
Genome map
NT seq 93 nt NT seq  +upstreamnt  +downstreamnt
ggaggaatacccaagtccggctgaagggatcggtcttgaaaaccgacaggggtgtcaaag
cccgcgggggttcgaatccctcttcctccgcca

DBGET integrated database retrieval system