KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_83
Entry
BSU_tRNA_83       tRNA      T00010                                 

Gene name
trnSL-Val2
Definition
(RefSeq) tRNA-Val
  KO
K14237  tRNA Val
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_83 (trnSL-Val2)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_83 (trnSL-Val2)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_83 (trnSL-Val2)
SSDB
Other DBs
NCBI-GeneID: 8303193
Position
1262789..1262861
NT seq 73 nt   +upstreamnt  +downstreamnt
gattccgtagctcagctgggagagcgctaccttgacagggtagaggtcgctggttcgagc
ccagtcggaatca

DBGET integrated database retrieval system