KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_85Help
Entry
BSU_tRNA_85       tRNA      T00010                                 

Gene name
trnSL-Arg1
Definition
(RefSeq) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_85 (trnSL-Arg1)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_85 (trnSL-Arg1)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_85 (trnSL-Arg1)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 8303040
Position
complement(2003276..2003348)
Genome map
NT seq 73 nt NT seq  +upstreamnt  +downstreamnt
gctctagtagcacagcggatagtgcagcagtttcctaaactgcaggtcgggagttcgaat
ctctcctagagcg

DBGET integrated database retrieval system