KEGG   Bos taurus (cow): 100126828
Entry
100126828         ncRNA     T01008                                 

Gene name
RMRP
Definition
(RefSeq) RNA component of mitochondrial RNA processing endoribonuclease
  KO
K14576  small nucleolar RNA MRP
Organism
bta  Bos taurus (cow)
Pathway
bta03008  Ribosome biogenesis in eukaryotes
Brite
KEGG Orthology (KO) [BR:bta00001]
 09120 Genetic Information Processing
  09122 Translation
   03008 Ribosome biogenesis in eukaryotes
    100126828 (RMRP)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03009 Ribosome biogenesis [BR:bta03009]
    100126828 (RMRP)
  09184 RNA family
   03100 Non-coding RNAs [BR:bta03100]
    100126828 (RMRP)
Ribosome biogenesis [BR:bta03009]
 Related small nucleolar RNAs
  Other snoRNA
   100126828 (RMRP)
Non-coding RNAs [BR:bta03100]
 Small non-coding RNA
  Small nucleolar RNA
   100126828 (RMRP)
SSDB
Other DBs
NCBI-GeneID: 100126828
Ensembl: ENSBTAG00000042458
Position
8
NT seq 279 nt   +upstreamnt  +downstreamnt
gttcgtgctgaaggcctgtttcctaggctacatacggaggactagttccttgtttgcgcc
taggggaaagtccccggaccgtgggcagagagtgccacgtgcccgtgcacgtagacttcc
cctgcttctcacgactaaacccgccaagaagcgatcctaccctgggggtggggaagccga
gcggcgtgttgcggggtgtcatccgtcagcttctaatagttacgcaggcagtgcctccat
gcgcaccaacctcacggggctcattctcagcacgtctca

DBGET integrated database retrieval system