KEGG   Burkholderia lata: Bcep18194_B1009Help
Entry
Bcep18194_B1009   CDS       T00286                                 

Definition
(GenBank) Pyruvate dehydrogenase (lipoamide)
  KO
K00163  pyruvate dehydrogenase E1 component [EC:1.2.4.1]
Organism
bur  Burkholderia lata
Pathway
bur00010  Glycolysis / Gluconeogenesis
bur00020  Citrate cycle (TCA cycle)
bur00620  Pyruvate metabolism
bur01100  Metabolic pathways
bur01110  Biosynthesis of secondary metabolites
bur01120  Microbial metabolism in diverse environments
bur01130  Biosynthesis of antibiotics
bur01200  Carbon metabolism
Module
bur_M00307  Pyruvate oxidation, pyruvate => acetyl-CoA
Brite
KEGG Orthology (KO) [BR:bur00001]
 Metabolism
  Carbohydrate metabolism
   00010 Glycolysis / Gluconeogenesis
    Bcep18194_B1009
   00020 Citrate cycle (TCA cycle)
    Bcep18194_B1009
   00620 Pyruvate metabolism
    Bcep18194_B1009
Enzymes [BR:bur01000]
 1. Oxidoreductases
  1.2  Acting on the aldehyde or oxo group of donors
   1.2.4  With a disulfide as acceptor
    1.2.4.1  pyruvate dehydrogenase (acetyl-transferring)
     Bcep18194_B1009
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ABB11123
UniProt: Q398I8
Position
2:complement(1135588..1136706)
Genome map
AA seq 372 aa AA seqDB search
MQTARSGPPVRTPDTRRAAAACLERLLTQRLAPRGRAVSPLGAMRAAADCLERDAATSER
VWIVRADAREPSADTGAHRRISAWPLRFLDARKRFEKPLLYLLHARATDRLRLASVETID
RGIFVNDAETVASSWPKGVTPDVPHWLAANPACTPYDPASGHEAIAILRHALRTLYVAGQ
PGFCYLASHDNLVPDAKPLSATAARDAFSGMVRAGRRAAAGAAAQIRLCGAGSTLAQVME
AADLLHDEWRVDSTIWSCPSYTQLARDGHAADRWNLLHPQDEPQIAHVRRCFGDSRTPVL
AVTGYAGHVAAQIGAFVPARFAVLGADLAGPSPGTRVPGARWIAAVALRLLADDGRVPAD
WAAQAMRRYASG
NT seq 1119 nt NT seq  +upstreamnt  +downstreamnt
atgcagactgcgcgatccggtccgcccgtgcggacacccgacacccgccgcgccgcggcg
gcctgcctcgaaaggctgctgacgcagcggctcgcgccgcgtggccgcgcggtgtcgccg
ctcggtgcgatgcgtgccgccgccgattgtctcgaacgcgatgccgcgacatcggagcgc
gtatggatcgtgcgtgccgatgcgcgggagccgtctgctgacacgggagcccatcgccgc
atcagcgcatggccgctgcggtttctcgatgcgcgcaagcggttcgagaaacccctgctg
tacctgctgcatgcgcgcgcgaccgaccggctgcggctggcgtcggtcgaaaccatcgat
cgcgggatcttcgtcaacgatgccgaaacggtcgcgtcgtcctggccgaaaggcgtgacg
cccgacgtcccgcactggctggccgcgaaccccgcgtgcacgccgtacgatccggcttcg
gggcatgaggcgatcgcgatcctgcgccacgcgctgcgcacgctttatgtcgccggccag
ccgggattctgttacctcgcgagccacgacaacctcgtgcccgatgcgaaaccgctgtcg
gccacggcggcccgcgatgcattcagcggcatggtgcgcgccggccggcgcgcggcagcg
ggcgcggccgcgcagatccggctgtgcggcgcgggcagcacgctcgcgcaggtgatggaa
gcggccgatctgctgcacgacgaatggcgcgtcgattcgacgatctggagctgcccgagc
tacacgcagctcgcccgcgacggtcacgcggccgaccggtggaacctgctgcacccgcag
gacgaaccgcagatcgcgcatgtgcgccgatgcttcggcgacagccgcacaccggtgctc
gcggtgacgggctacgcggggcacgtcgccgcgcagatcggcgcgttcgtaccggcccgc
ttcgcggtgctcggcgcggatctggccggcccgagccccggtacgcgcgtgccgggtgcg
cgctggatcgccgcggtggcgcttcgcctgctggccgacgacggccgcgtgccggccgac
tgggccgcgcaggcaatgcgccgctatgcgagcggctga

DBGET integrated database retrieval system