KEGG   Bacteroides vulgatus: BVU_2863Help
Entry
BVU_2863          tRNA      T00546                                 

Definition
(GenBank) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
bvu  Bacteroides vulgatus
Pathway
bvu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bvu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BVU_2863
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bvu03100]
    BVU_2863
Non-coding RNAs [BR:bvu03100]
 Transfer RNA
  tRNA
   BVU_2863
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(3633700..3633774)
Genome map
NT seq 75 nt NT seq  +upstreamnt  +downstreamnt
ggacgattagctcagaggcagagcatcagcttcccaagctgagggtcgcgggttcaagtc
ccgtatcgtccacga

DBGET integrated database retrieval system