KEGG   Cellulophaga algicola: Celal_0070Help
Entry
Celal_0070        CDS       T01404                                 

Definition
(GenBank) 6-phosphogluconate dehydrogenase
Organism
cao  Cellulophaga algicola
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ADV47428
UniProt: E6X6C8
Position
73506..73871
Genome map
AA seq 121 aa AA seqDB search
MKKIIGLIIVAIITIFGAYYAFVYFVPYSEGIRSGELIKISYKGMAVKTWEGEISQGISG
AQIFEFSVLDKDKEVIQKLKDYQGQYVKLDYIERYRTFFWLGDSKYFVTKVQKENSPGYR
N
NT seq 366 nt NT seq  +upstreamnt  +downstreamnt
atgaaaaaaataattggattaataattgttgcaataatcacaatatttggagcgtactat
gcttttgtatattttgtgccctacagtgaaggcatacgctccggagagcttattaaaata
agctataaaggaatggctgttaaaacctgggaaggagaaattagccaaggaatttctgga
gctcaaatttttgaattctctgttttagataaagacaaagaggtaattcagaaattaaaa
gattatcaaggtcaatatgtaaagctagattatatagaacgttacagaacattcttttgg
ttaggagattctaaatattttgtaactaaagtacaaaaagaaaattcacctggttaccgc
aattaa

DBGET integrated database retrieval system