KEGG   Cellulophaga algicola: Celal_0141Help
Entry
Celal_0141        gene      T01404                                 

Definition
(GenBank) pseudogene
Organism
cao  Cellulophaga algicola
SSDB OrthologParalogGene clusterGFIT
Position
complement(154628..154828)
Genome map
NT seq 201 nt NT seq  +upstreamnt  +downstreamnt
atgttttacatccagagcggtagcgattatgaagtagtagatccagagattggaactata
gtttacgagcttccgagtgattacgaaaaagtgacaattgatggtcaaacttattatgaa
tatggaaacatactttatgaaaaagtacaagataacggtgcaagagcttacgaagtggta
ggttttattgatgtcaattaa

DBGET integrated database retrieval system