KEGG   Clostridium beijerinckii NCIMB 8052: Cbei_0695Help
Entry
Cbei_0695         gene      T00547                                 

Definition
(GenBank) pseudogene
Organism
cbe  Clostridium beijerinckii NCIMB 8052
SSDB OrthologParalogGene clusterGFIT
Position
complement(837158..837824)
Genome map
NT seq 667 nt NT seq  +upstreamnt  +downstreamnt
atgtcaagaaaaatgaaatgttctttagaagagaaagtgaaaggaattacagaatatcta
ttaggagaaaaagcagttgtacagatatgcgatgagttggtaattcatagtgccactttt
tatgactggttaaaaatatataatgatgttggtgaagcaaatttaatagtttctacaaaa
aacaaatattattctgattcgcttaaacttatatctagctggaaaaggctctttaagaaa
tatatgctgcacatatgaaatttcatctcctcgtgttctcagagattggattaagaagta
taatggtcataaaacaattaaatctcataataagcaaggggatagaattatgactaatgg
aagaaagactacttatgaagaaagaattgagattgttgcattctgcatttcgaataatga
tgattatcaagctactgctgataaatttaatgtttcttatcaacaagtttatacctgggt
aagaaaatacaaagctaatggatatgaagagctaatagaccgtcgcggtaagcgtaaaga
tactgatgagattactgagtctgataaattatccgcacaattaaaacttattgaagcaga
aaatagacgtttaaagatggagattgatttcttaaaaaaattgaaggaagtagaaagaag
gcgataa

DBGET integrated database retrieval system