KEGG   Clostridium beijerinckii NCIMB 8052: Cbei_R0066Help
Entry
Cbei_R0066        tmRNA     T00547                                 

Gene name
ssrA
Definition
(GenBank) ssrA
  KO
K15035  transfer-messenger RNA
Organism
cbe  Clostridium beijerinckii NCIMB 8052
Brite
KEGG Orthology (KO) [BR:cbe00001]
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:cbe03100]
    Cbei_R0066 (ssrA)
Non-coding RNAs [BR:cbe03100]
 Other RNA
  Unclassified
   Cbei_R0066 (ssrA)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
805096..805452
Genome map
NT seq 357 nt NT seq  +upstreamnt  +downstreamnt
gggggcgttttggcttcgacgggggtaagaagggtttgttaagcgagtcgagggacgcat
ggagcctcgttaaaaaagtatgcactaaatgtaaacgcagaagataattttgcattagca
gcttagtttaatagctgttcatcagcccaggttgcctacggcttggatcactggtgtcat
taaagtgggaaacgaagcctagcaaagctttgagctagaggggtattcatgaagctactg
agaagtatagcctgtctaagggcgatactttgagggaattttaaaacttagactgcactc
ggagaaagataaatcaatctactttcggacacgggttcgacacccgtcgcctccacc

DBGET integrated database retrieval system