KEGG   Clostridium beijerinckii NCIMB 8052: Cbei_R0068Help
Entry
Cbei_R0068        tRNA      T00547                                 

Definition
(GenBank) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
cbe  Clostridium beijerinckii NCIMB 8052
Pathway
cbe00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:cbe00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Cbei_R0068
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:cbe03100]
    Cbei_R0068
Non-coding RNAs [BR:cbe03100]
 Transfer RNA
  tRNA
   Cbei_R0068
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
926564..926639
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
gggggtttagctcagttgggagagcacctgccttgcacgcagggggtcaagggttcgaat
cccttaatctccacca

DBGET integrated database retrieval system