KEGG   Corallococcus coralloides: COCOR_02453Help
Entry
COCOR_02453       tRNA      T01780                                 

Definition
(GenBank) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
ccx  Corallococcus coralloides
Pathway
ccx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:ccx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    COCOR_02453
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:ccx03100]
    COCOR_02453
Non-coding RNAs [BR:ccx03100]
 Transfer RNA
  tRNA
   COCOR_02453
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(2968867..2968950)
Genome map
NT seq 84 nt NT seq  +upstreamnt  +downstreamnt
gcccaggtggtggaattggtagacacactagattcagggtctagcgcctgcaagggcatg
gaggttcgagtcctctcctgggca

DBGET integrated database retrieval system