KEGG   Corallococcus coralloides: COCOR_02467Help
Entry
COCOR_02467       CDS       T01780                                 

Definition
(GenBank) hypothetical protein
Organism
ccx  Corallococcus coralloides
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AFE04658
UniProt: H8MQR7
Position
2981436..2981687
Genome map
AA seq 83 aa AA seqDB search
MDGKTPHRGDAMYRIDAWSQGDGALWAPGSNGGAGVRPEDEAREARGYRVGEQVGDGDED
SRHEGEESPFDFEDSDLDWVASY
NT seq 252 nt NT seq  +upstreamnt  +downstreamnt
gtggacggcaagacaccgcaccggggggacgcgatgtaccgcatcgatgcgtggagccag
ggggacggtgcgctgtgggcgcccggttccaacgggggcgcgggcgtgcggccggaggac
gaggcccgggaggcgcgggggtaccgggttggggagcaggtgggggacggggacgaggac
tcgcggcacgaaggcgaggaatcgcccttcgatttcgaggacagcgacctggattgggtc
gccagctactga

DBGET integrated database retrieval system