KEGG   Corallococcus coralloides: COCOR_02489Help
Entry
COCOR_02489       CDS       T01780                                 

Definition
(GenBank) putative lipoprotein
Organism
ccx  Corallococcus coralloides
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AFE04671
UniProt: H8MQT9
Position
3004977..3005594
Genome map
AA seq 205 aa AA seqDB search
MGAMRMLGWGVLLLSTACGASRTAVTKAEPGTGGSGMVSDEAAVASTTRRYVDEDLGFEI
IRPTAEWQLDETNERTPEGLAIPVILRHRVTGAQVVLQVAPGVATPVQFAERLTQGLRQQ
PGFTTTDPQPIALSDNAVGFDFQVGEGVRGKVAVREGNSGRVLMMLATWPTEATAGITES
VDALMAGVRPLPEPSVAVRSTPRTP
NT seq 618 nt NT seq  +upstreamnt  +downstreamnt
atgggcgcgatgcggatgttgggttggggtgtgcttctgctgagcactgcgtgtggcgcg
tcccggacggcggtgacgaaggcggagcccggcacgggcggttccggaatggtgtcggat
gaggccgctgtcgcgtccaccacgcggcgctacgtggacgaggacctgggcttcgaaatc
atccggcccacggcggagtggcagctggatgagacgaacgagcgcaccccggaggggctg
gcgattcccgtcatcctgcgccaccgcgtgacgggcgcgcaggtggtgctgcaggtggcg
cccggcgtggccacgcccgtgcagttcgcggagcggctgacgcaggggctgcgccagcag
ccgggcttcaccaccacggatccgcagcccatcgcgctgtcggacaacgccgtggggttc
gacttccaggtgggggagggcgtgcgcggcaaggtggccgtgcgcgagggcaactccggc
cgcgtgctgatgatgctggccacctggcccacggaggccaccgccggcatcacggagagc
gtggacgccctgatggcgggcgtccgtccgctgccggagccgagcgtggcggtgcgttca
acgccccgcacgccctga

DBGET integrated database retrieval system