KEGG   Corynebacterium diphtheriae INCA 402: CDB402_t010Help
Entry
CDB402_t010       tRNA      T01688                                 

Definition
(GenBank) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
cdh  Corynebacterium diphtheriae INCA 402
Pathway
cdh00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:cdh00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    CDB402_t010
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:cdh03100]
    CDB402_t010
Non-coding RNAs [BR:cdh03100]
 Transfer RNA
  tRNA
   CDB402_t010
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
150476..150551
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
gcgcccgtagctcaacggatagagcatctgactacggatcagaaggttgggggttcgaat
ccctccgggcgcacaa

DBGET integrated database retrieval system