KEGG   Corynebacterium diphtheriae C7: CDC7B_t017Help
Entry
CDC7B_t017        tRNA      T01699                                 

Definition
(GenBank) tRNA-Thr
  KO
K14234  tRNA Thr
Organism
cds  Corynebacterium diphtheriae C7
Pathway
cds00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:cds00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    CDC7B_t017
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:cds03100]
    CDC7B_t017
Non-coding RNAs [BR:cds03100]
 Transfer RNA
  tRNA
   CDC7B_t017
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
377339..377411
Genome map
NT seq 73 nt NT seq  +upstreamnt  +downstreamnt
gcccccttagctcagtcggcagagcgtttccatggtaaggaaaaggtcgacagttcgatt
ctgtcagggggct

DBGET integrated database retrieval system