KEGG   Caenorhabditis elegans (nematode): CELE_Y49F6B.5Help
Entry
CELE_Y49F6B.5     CDS       T00019                                 

Gene name
sdz-32
Definition
(RefSeq) SKN-1 Dependent Zygotic transcript
Organism
cel  Caenorhabditis elegans (nematode)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 190080
NCBI-ProteinID: NP_494556
WormBase: WBGene00021717
Ensembl: WBGene00021717
UniProt: Q9N4U8
Position
II:join(3474054..3474190,3474241..3474668,3474713..3474729)
Genome map
AA seq 193 aa AA seqDB search
MILPTSVEFFLPNFSKSSEKIEKTAVELTTDLAKKEVLKFLPIRIRQHLQLCSNCSNLKR
LDSTTPYQLETCSVGKNLIELDFFGCSWSFGGKGKVTLRFGGGLRKELDLKIPKEESMRR
ILKFYLTRKGTIVKKLWIKDQESVKLLASMGVFNKFNVSNQEGVLLENLEDLDDFTLSKI
TWKLVDPRSYKLV
NT seq 582 nt NT seq  +upstreamnt  +downstreamnt
atgattctcccaacatccgttgaattcttcctcccaaacttttccaagagctccgaaaaa
attgagaagaccgcggtcgaattgacgacggacttggcgaaaaaagaagtattgaagttt
ttgccaatcaggatcagacaacatctacagctctgctccaactgctccaacttaaaacgg
ctggactccacaaccccataccagctggagacctgctcagtgggcaaaaatctcatcgag
ctggactttttcggttgctcttggagctttggcggaaagggcaaggtgactcttcgattt
ggaggtggacttcggaaggagttggatttaaagatcccaaaggaagaatcaatgcgaaga
attctaaaattctacctaacccggaaagggaccattgtgaagaagctgtggatcaaggat
caggaatcagtgaagcttttggcttcgatgggggttttcaataaatttaatgtgtcgaat
caggaaggtgtattgttggagaatctggaggatttggacgattttacgctgtcgaagatc
acctggaaacttgtggacccacgttcttacaaacttgtttaa

DBGET integrated database retrieval system