KEGG   Canis familiaris (dog): 608367Help
Entry
608367            CDS       T01007                                 

Gene name
EID1
Definition
(RefSeq) EP300-interacting inhibitor of differentiation 1
Organism
cfa  Canis familiaris (dog)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 608367
NCBI-ProteinID: XP_850599
Ensembl: ENSCAFG00000014800
VGNC: 40252
UniProt: J9P939
Position
30
AA seq 191 aa AA seqDB search
MSEMNELSELYEESNDLQMDVMPGEGDLPQMEVGGGSREPSPNPSRHGAQPQLEEEGPME
EEAAQPMAEPQGERGLAHRPSPGEQPGQLAGPDFESEDEGEEFDDWEDDYDYPEEEQLSG
AGYRVSAALEEANKMFLRTSRAREAALDGGFQMHYEKTPFDQLAFIEELFSLMVVNRLTE
ELGCDEIIDRE
NT seq 576 nt NT seq  +upstreamnt  +downstreamnt
atgtcggagatgaacgagctgtccgagctgtatgaagagagcaatgacctgcagatggat
gtgatgcccggcgagggtgaccttccgcagatggaggtaggcggcgggagccgggagccc
tccccgaacccctcccgccacggggcccagccgcagctggaggaggaaggcccgatggag
gaggaggcggcccagccaatggcggagccgcagggggaacgaggccttgctcaccggccc
agcccgggggagcagccgggccagctcgccggccctgacttcgagagcgaggacgagggt
gaggagtttgatgactgggaggacgactacgattatccggaagaggagcaactgagtggt
gccggctacagggtatccgcggccctggaggaagccaacaagatgttcctgagaacatcc
agagccagagaagcagccctggatggcgggtttcaaatgcattacgagaagaccccgttt
gatcagttggctttcatcgaagagcttttttcacttatggttgtcaatcgcctgaccgaa
gaactcggctgtgatgagattattgacagagagtga

DBGET integrated database retrieval system