KEGG   Ciona intestinalis (sea squirt): 100145819Help
Entry
100145819         CDS       T01056                                 

Gene name
mama
Definition
(RefSeq) molecule against microbes A precursor
Organism
cin  Ciona intestinalis (sea squirt)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 100145819
NCBI-ProteinID: NP_001119701
UniProt: B1PVV5
Position
1
AA seq 81 aa AA seqDB search
MDRKIVFALLLLVSLNVSTVYGWSSLGRSLLRLTHALKPLARRSGWDQRAASLNFAPEIE
DELEASEMDRIMQQMADEKQD
NT seq 246 nt NT seq  +upstreamnt  +downstreamnt
atggatcgaaagattgtttttgctcttcttctcttggtgtctctcaacgtttctacggtt
tatggatggagttctcttggtcgctctctactccgcttaacgcatgcacttaaaccttta
gctcgccgatcagggtgggatcaacgagctgcttctttgaactttgctccagaaattgag
gatgaattagaagcgtctgagatggatcgtatcatgcaacaaatggcagacgaaaaacaa
gactag

DBGET integrated database retrieval system