KEGG   Campylobacter jejuni subsp. jejuni S3: CJS3_0954Help
Entry
CJS3_0954         CDS       T01856                                 

Gene name
hup
Definition
(GenBank) DNA-binding protein HU-beta
  KO
K03530  DNA-binding protein HU-beta
Organism
cjs  Campylobacter jejuni subsp. jejuni S3
Brite
KEGG Orthology (KO) [BR:cjs00001]
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03032 DNA replication proteins [BR:cjs03032]
    CJS3_0954 (hup)
   03036 Chromosome and associated proteins [BR:cjs03036]
    CJS3_0954 (hup)
   03400 DNA repair and recombination proteins [BR:cjs03400]
    CJS3_0954 (hup)
DNA replication proteins [BR:cjs03032]
 Prokaryotic Type
  DNA Replication Initiation Factors
   Initiation factors (bacterial)
    CJS3_0954 (hup)
Chromosome and associated proteins [BR:cjs03036]
 Prokaryotic Type
  Nucleoid associated proteins
   HU (heat unstable protein)
    CJS3_0954 (hup)
DNA repair and recombination proteins [BR:cjs03400]
 Prokaryotic Type
  DSBR (double strand breaks repair)
   NHEJ (non-homologous end-joining)
    SHIIR (short-homology-independent illegitimate recombination)
     Supressor
      CJS3_0954 (hup)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: Bac_DNA_binding DUF2267 DUF4496
Motif
Other DBs
NCBI-ProteinID: ADT72682
Position
complement(882073..882369)
Genome map
AA seq 98 aa AA seqDB search
MTKADFISLVAQTAGLTKKDATTATDAVISTITDVLAKGDSISFIGFGTFSTQERAAREA
RVPSTGKTIKVPATRVAKFKVGKNLKEAVAKASGKKKK
NT seq 297 nt NT seq  +upstreamnt  +downstreamnt
atgactaaagcagattttatttcattagttgctcaaacagctgggctaacaaaaaaagac
gctactactgctactgatgcagttatttctactattactgatgttttagctaaaggtgat
agcatcagttttattggttttggtactttttcaactcaagaaagagctgctagagaagct
agagtaccaagcacaggaaaaacaatcaaagttcctgctacaagagttgcaaaatttaag
gtaggtaaaaaccttaaagaagctgttgcaaaagcaagcggcaaaaagaaaaaataa

DBGET integrated database retrieval system