KEGG   Campylobacter jejuni subsp. jejuni S3: CJS3_0958Help
Entry
CJS3_0958         gene      T01856                                 

Definition
(GenBank) pseudogene
Organism
cjs  Campylobacter jejuni subsp. jejuni S3
SSDB OrthologParalogGene clusterGFIT
Position
complement(884996..887107)
Genome map
NT seq 2112 nt NT seq  +upstreamnt  +downstreamnt
atgactcagttaagtactaaaattttatggttgtttgttgcaactttaggcgctatttgt
tttggttatttagctttacaaaatggcgaaagtgtatcagcgatttatttggtggttgct
gctgtatgtatttatatgataggatatagattttatgggcgttttgtagcttataaggtt
ttagaacttgataaaaatcgtgcaacaccagcacttgtagaaaatgatgggcgtgatttt
gtgcctacaaataaagctgtattatttggacatcattttgctgctattgcaggagcaggt
ccattagtaggacctatcttggctgctcaaatgggatatttgccttccatgctttggatt
ttagtaggaggagttttagcgggtgctgtgcatgattttgttgttctttttatatctact
cgtagaaaaggtagaagtcttggcgagatgattaaggatgagatgggtaaatttacaggt
ggagttgctatggtggcgatttttggcattatgcttattattattgccattttagctatg
gtggttgtaaaagctttagcagaatctccatggggtttatttactatcgcaatgactatt
cctatagcaatatttatgggcatttatatgcgttttatccgtccaggtagagtaggggag
gcttctataataggttttgtgcttttaattttggctattcattatggtagcgttatagct
gctgatccttattgggctaaaatatttactttagaagctccaattttggcaattgttatg
atggcttatggttttattgcttctgttttacctgtgtggtttttacttgctccaagagat
tatctttcaacttttttgaaaatcggtgttattgtggtaatggctgtagctattgttttg
gttgctcctgatttacaaatgccaaaagcaaatactcagtattttgatggaacaggtcca
gtatttgcaggtggagtgtttccatttttatttattaccattgcttgtggtgcgatcagt
ggttttcatgctttgatttctagtggaactactcctaaaatgctttaaaacgaaactcat
gctttggctgttggatatggctctatgcttgctgagagtgctgtggcgattatggcttta
atttgtgcttgtattttacatccaggtctttattttgctataaattcaagctctgctttg
ataggaacagatgttgtaaatgtagcacaaactatttcaagttggggatttagtattact
cctgaagaaattactactttaaccacaaatataggagagcatactatactttcaagaaca
gggggagccccgacttttgctataggtgtagctttgatcttacatgaactttttggcggc
gtggatttgatggctttttggtatcattttgctatattgtttgaagctttatttatttta
acagcggtggatgctgggacaagggcttgtcgttttatggtgcaagatatattgggtaat
gtttataaacctttaggagatattcataattatccagctggacttttggctacggcttta
agtgttgcaggttggggatattttctttatcaaggtgccattgatcctaagggaggaatt
tatacgctttggcctctttttggcgtgagtaatcaaatgcttgcgggtatggctttactt
cttgctacaactatacttgtaaaaatgggcaaggcaagatatacttgggttactttagta
cctgcggtatttgtcttagtggcaactctgtatggaggaattcaaaaaattatgccttat
gaagaaggcaataaagtagcaaatgcggtaagtcatgtagccgccgttagcatacaaagt
caaaaaattaaagatttagaatttaaattaaataatactaaagatgaaaaagaaatttct
gtaattaaaaaagaaatttcaatagccactcaaagtaaagttggaaatttgcttaatgca
attctttgtgtgttctttatgatagctaccttgcttgttataatttcttgtataggaatt
tgtttaggtaaaattaaaattcctcttaaagaaactaagtatattaagattgatgaattt
caaaaaatttaa

DBGET integrated database retrieval system