KEGG   Campylobacter jejuni subsp. jejuni S3: CJS3_1836Help
Entry
CJS3_1836         tRNA      T01856                                 

Definition
(GenBank) tRNA-Val
  KO
K14237  tRNA Val
Organism
cjs  Campylobacter jejuni subsp. jejuni S3
Pathway
cjs00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:cjs00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    CJS3_1836
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:cjs03100]
    CJS3_1836
Non-coding RNAs [BR:cjs03100]
 Transfer RNA
  tRNA
   CJS3_1836
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(910859..910934)
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
ggtcgcttagctcagttggtagagcgccacccttacaaggtggatgtcataagttcgagt
cttatagtgaccacca

DBGET integrated database retrieval system