KEGG   Campylobacter jejuni subsp. jejuni S3: CJS3_1839Help
Entry
CJS3_1839         tRNA      T01856                                 

Definition
(GenBank) tRNA-Asp
  KO
K14221  tRNA Asp
Organism
cjs  Campylobacter jejuni subsp. jejuni S3
Pathway
cjs00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:cjs00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    CJS3_1839
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:cjs03100]
    CJS3_1839
Non-coding RNAs [BR:cjs03100]
 Transfer RNA
  tRNA
   CJS3_1839
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(911116..911192)
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
gcagcggtagttcagctggttagaatgccgccctgtcacggcggaggtcgcgggttcgag
ccccgtccgctgcgcca

DBGET integrated database retrieval system