KEGG   Columba livia (rock pigeon): 110356600Help
Entry
110356600         CDS       T02912                                 

Gene name
BLVRB
Definition
(RefSeq) flavin reductase (NADPH)
  KO
K05901  biliverdin reductase / flavin reductase [EC:1.3.1.24 1.5.1.30]
Organism
clv  Columba livia (rock pigeon)
Pathway
clv00740  Riboflavin metabolism
clv00860  Porphyrin and chlorophyll metabolism
clv01100  Metabolic pathways
Brite
KEGG Orthology (KO) [BR:clv00001]
 09100 Metabolism
  09108 Metabolism of cofactors and vitamins
   00740 Riboflavin metabolism
    110356600 (BLVRB)
   00860 Porphyrin and chlorophyll metabolism
    110356600 (BLVRB)
Enzymes [BR:clv01000]
 1. Oxidoreductases
  1.3  Acting on the CH-CH group of donors
   1.3.1  With NAD+ or NADP+ as acceptor
    1.3.1.24  biliverdin reductase
     110356600 (BLVRB)
  1.5  Acting on the CH-NH group of donors
   1.5.1  With NAD+ or NADP+ as acceptor
    1.5.1.30  flavin reductase (NADPH)
     110356600 (BLVRB)
BRITE hierarchy
SSDB OrthologParalogGFIT
Motif
Pfam: NAD_binding_10 3Beta_HSD NmrA Epimerase
Motif
Other DBs
NCBI-GeneID: 110356600
NCBI-ProteinID: XP_021139183
Position
Unknown
AA seq 82 aa AA seqDB search
RDRARLPALSPPPARVLVGDVRDPEVVAEAVRGQDAVIIVLGTRDDLGPTTVMSEGTRNI
VAAMKTHGVRRVVACLSGGCPP
NT seq 246 nt NT seq  +upstreamnt  +downstreamnt
cgggatcgggcccggctgcccgcgctgtccccgccccccgcgcgcgtgctggtcggggac
gtgcgggaccccgaggtggtggccgaggccgtgcggggacaggacgccgtgatcatcgtg
ttggggacacgggacgacctgggccccacgaccgtcatgtccgagggtacccggaacatc
gtggccgccatgaagacccacggcgtgcgcagggtggtggcctgtctgtccggtgggtgt
ccccct

DBGET integrated database retrieval system