KEGG   Cupriavidus necator N-1: CNE_1c27920Help
Entry
CNE_1c27920       CDS       T01564                                 

Definition
(GenBank) hypothetical protein
Organism
cnc  Cupriavidus necator N-1
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AEI78106
UniProt: G0ETQ7
Position
1:complement(2893661..2893792)
Genome map
AA seq 43 aa AA seqDB search
MSDPETEDEDLAGRAAHLAVARISQVAMTGGAGLANPASRRLH
NT seq 132 nt NT seq  +upstreamnt  +downstreamnt
ttgtcggatccagaaaccgaggatgaagatctcgccggcagggcggcgcatctcgcagtg
gcgcgcatcagccaggtcgccatgacaggtggcgctggcctcgcgaaccctgcgtcacgc
cggctgcattag

DBGET integrated database retrieval system