KEGG   Corynebacterium pseudotuberculosis 1002: Cp1002_2049Help
Entry
Cp1002_2049       CDS       T01876                                 

Definition
(GenBank) Hypothetical protein
Organism
cpk  Corynebacterium pseudotuberculosis 1002
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ADL21905
Position
2267563..2267682
Genome map
AA seq 39 aa AA seqDB search
MSAELLSSLSNSSLSTVVELLKSVTKILSLFTKVTGILS
NT seq 120 nt NT seq  +upstreamnt  +downstreamnt
atgtcagctgaacttctttccagcctgtctaactctagcctctccaccgttgttgagctc
ctcaagtccgtcaccaagatcctgagcctcttcaccaaggtcacgggcatcctttcctaa

DBGET integrated database retrieval system