KEGG   Chlamydia pecorum E58: G5S_0134Help
Entry
G5S_0134          tRNA      T01466                                 

Definition
(GenBank) tRNA-Cys
  KO
K14222  tRNA Cys
Organism
cpm  Chlamydia pecorum E58
Pathway
cpm00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:cpm00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    G5S_0134
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:cpm03100]
    G5S_0134
Non-coding RNAs [BR:cpm03100]
 Transfer RNA
  tRNA
   G5S_0134
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
136078..136148
Genome map
NT seq 71 nt NT seq  +upstreamnt  +downstreamnt
ggtggcatagccaagcggtaaggccgaggcctgcaaagcctctatccccggttcgattcc
gggtgccacct

DBGET integrated database retrieval system