KEGG   Chlamydia pecorum E58: G5S_0153Help
Entry
G5S_0153          rRNA      T01466                                 

Definition
(GenBank) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
cpm  Chlamydia pecorum E58
Pathway
cpm03010  Ribosome
Brite
KEGG Orthology (KO) [BR:cpm00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    G5S_0153
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:cpm03011]
    G5S_0153
  09184 RNA family
   03100 Non-coding RNAs [BR:cpm03100]
    G5S_0153
Ribosome [BR:cpm03011]
 Ribosomal RNAs
  Prokaryotes
   G5S_0153
Non-coding RNAs [BR:cpm03100]
 Ribosomal RNA
  Large subunit rRNA
   G5S_0153
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(158887..158998)
Genome map
NT seq 112 nt NT seq  +upstreamnt  +downstreamnt
ggtgatattggaaaaagggacacacctgataccattccgaactcagaagttaagcctttt
atcgctgatggtactatacacaagagtatgggagagtaagtcgttgccaagc

DBGET integrated database retrieval system