KEGG   Clostridium perfringens SM101: CPR_0872Help
Entry
CPR_0872          CDS       T00379                                 

Definition
(GenBank) hypothetical protein
Organism
cpr  Clostridium perfringens SM101
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: FliX
Motif
Other DBs
NCBI-ProteinID: ABG86136
UniProt: Q0SUL0
Position
1009731..1010156
Genome map
AA seq 141 aa AA seqDB search
MESKEMRLAKKAKKLIDEFERVQSVLLSGELSEQEVEIRDDGATIVLKNIMPGYSGEAIF
KLTHISDVVKAYIDDVDEENDEMIKSYEVENTNWHESDLGDIYREAAIEHLEKVEVVQDK
VRHTYKELKKIEEKAREIEGL
NT seq 426 nt NT seq  +upstreamnt  +downstreamnt
atggaatcaaaggaaatgagattagctaaaaaagcaaaaaaacttatagatgagtttgaa
agggttcaatcagttcttttaagtggagaattatcagagcaagaagtggaaataagagat
gatggagctactattgttcttaaaaatataatgccaggatatagtggagaagctattttt
aagttaactcatatatctgatgtggttaaagcttacattgatgatgtggatgaagaaaat
gatgaaatgattaaaagttacgaagttgaaaatactaattggcatgaaagtgatttaggg
gatatttacagagaagctgctattgaacatttagaaaaagttgaagtggtacaagataaa
gttaggcatacgtataaggaacttaaaaagatagaagagaaagctagagaaattgaagga
ctataa

DBGET integrated database retrieval system