KEGG   Clostridium perfringens SM101: CPR_0875Help
Entry
CPR_0875          CDS       T00379                                 

Definition
(GenBank) hypothetical protein
Organism
cpr  Clostridium perfringens SM101
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: GARS_A
Motif
Other DBs
NCBI-ProteinID: ABG85834
UniProt: Q0SUK7
Position
complement(1011471..1011644)
Genome map
AA seq 57 aa AA seqDB search
MKIGLASKEFINKDIEKNTNTIIETMIEAKEENYKGLLYCSYMTINENSEIINNFKI
NT seq 174 nt NT seq  +upstreamnt  +downstreamnt
atgaaaataggactagcatctaaagaatttataaataaagatattgaaaaaaatactaat
acaattatagaaactatgatagaagcaaaagaagaaaattacaaaggtttattatattgt
agctatatgacaattaatgaaaatagtgaaataataaataattttaaaatataa

DBGET integrated database retrieval system