KEGG   Clostridium perfringens SM101: CPR_0881Help
Entry
CPR_0881          CDS       T00379                                 

Definition
(GenBank) hypothetical protein
Organism
cpr  Clostridium perfringens SM101
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ABG86482
UniProt: Q0SUK0
Position
complement(1018287..1018376)
Genome map
AA seq 29 aa AA seqDB search
MDNNYWEIGNFIGNAFNIGKNIEATKTTH
NT seq 90 nt NT seq  +upstreamnt  +downstreamnt
atggacaataattattgggaaataggtaactttattggaaatgcctttaacataggaaaa
aatattgaggcaactaaaactacacactga

DBGET integrated database retrieval system